Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

periodically holed double-double crossover DNA tile array

Based on

1 Articles
2015 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

double-double crossover DNA nanostructure

Type Nano Material
Formula
Role raw materials

Properties

Applications

Characterization

Method Source
atomic force microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-d(TAGCAGTTACAGGATTGCC)-3'
  • 5'-d(CATACCGATCCGTGGCTACTGTCACTGCGGTTGTCCAACTTACCAGATCCTGTAGAGCACTAG)-3'
  • 5'-d(GTATGGGCAATCCACAACCGCAGTGACAGTAGCCTGCTATCTTATGGCGTCCAGAATGCTAGT)-3'
See all (6)
  1. GI337RbEhr0esrTTxNRNJtiBGRHgMden92VDyvK46opYfIZHotvnepgiwJ
  2. S5uR
Product

periodically holed double-double crossover DNA tile array

Method 2

Type: Physical formation
Source:
Starting materials
  • 5'-d(TAGCAGTTACAGGATTGCC)-3'
  • 5'-d(CATACCGATCCGTGGCTACTGTCACTGCGGTTGTCCAACTTACCAGATCCTGTAGAGCACTAG)-3'
  • 5'-d(GTATGGGCAATCCACAACCGCAGTGACAGTAGCCTGCTATCTTATGGCGTCCAGAATGCTAGT)-3'
See all (6)
  1. D99jhLo70QIxiJuJSAGYb1dMwe6vEOAyPm8jrZxPQF2NuyTbOkd8Cu2RT5
  2. mfXE
Product

periodically holed double-double crossover DNA tile array

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial