Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

double crossover DNA nanostructure

Based on

1 Articles
2015 Most recent source

Composition

1

5'-d(GCGGTTGTCCAACTTACCAGATCCACAAGCCGACGTTACAGGATTGCC)-3'

Type Biomolecule
Formula
Role framework element
2

5'-d(GCTCTACAGGATCTGGTAAGTTGGTGTAACGTCGGCTTGTCCGTTCGC)-3'

Type Biomolecule
Formula
Role framework element
3

5'-d(GTATGGGCAATCCACAACCGCAGTGA)-3'

Type Biomolecule
Formula
Role framework element
4

5'-d(CATACGCGAACGGTGTAGAGCACTAG)-3'

Type Biomolecule
Formula
Role framework element

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-d(GCTCTACAGGATCTGGTAAGTTGGTGTAACGTCGGCTTGTCCGTTCGC)-3'
  • 5'-d(GCGGTTGTCCAACTTACCAGATCCACAAGCCGACGTTACAGGATTGCC)-3'
  • 5'-d(CATACGCGAACGGTGTAGAGCACTAG)-3'
See all (4)
  1. upw7ZBB9OzC1th4Gwit75zPIBn25FKZG5M3IbuzAZbEXxulDgDv9auBLhb
  2. cwEx
Product

double crossover DNA nanostructure

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial