Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

array of hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, and 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead mixture

Based on

1 Articles
2015 Most recent source

Composition

1

hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; mixture of

Type Nano Material
Formula
Role raw materials

Properties

Applications

Area Application Source
diagnostics

More information available to subscribers only.

Or, view sample content

Characterization

Method Source
fluorescence microscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
  1. foKc3
  2. EBi6e
  3. ugSmoi6m9C
Product

array of hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, and 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead mixture

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial