Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

array of hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, and 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead mixture

Based on

1 Articles
2015 Most recent source



hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; mixture of

Type Nano Material
Role raw materials



Area Application Source

Full content is available to subscribers only

To view content please choose from the following:


Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects


Method 1

Type: Physical formation
  1. 3vCOH
  2. cecga
  3. ywjB2nA6Cr

array of hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead, and 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbead mixture


Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial