Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; 5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads; mixture of

Based on

1 Articles
2015 Most recent source



hepatitis B viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads

Type Nano Material
Role raw materials

hepatitis C viral DNA fragment-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads

Type Nano Material
Role raw materials

5'-d(GACAATGCTCACTGAGGATAGT)-3'-conjugated CdSeS/ZnS quantum dot/poly(styrene-co-maleic anhydride) microbeads

Type Nano Material
Role raw materials




Biological effects



Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial