Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

single-stranded deoxyribonucleic acid modified nanostructure gold

Based on

1 Articles
2012 Most recent source


Image only illustrates the order and placement of components as described in literature.



Type Single Compound
Formula Au
Role raw materials

5'-HS-d(TTGGAGGGCTGCGCCTGCACCC)-3'/mercaptohexanol mixture

Type Complex Compound
Role layer


General physical and chemical properties

Property Value Source
Nyquist plot

0 more entry available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Source
compounds sensor for survivin gene

0 more entry available to subscribers only.

Or, view sample content


Area Application Source

0 more entry available to subscribers only.

Or, view sample content


Method Source
dielectric spectroscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects


Method 1

Type: Physical formation
Starting materials
  1. PE77oMG4XTtTQ34
  2. ObMu0g

single-stranded deoxyribonucleic acid modified nanostructure gold


Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial