Loading ...

single-stranded deoxyribonucleic acid modified nanostructure gold

Based on

1 Articles
2012 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold

Type Single Compound
Formula Au
Role raw materials
2

5'-HS-d(TTGGAGGGCTGCGCCTGCACCC)-3'/mercaptohexanol mixture

Type Complex Compound
Formula
Role layer

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
Nyquist plot

More information available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Nanomaterial Variant Source
compounds sensor for survivin gene

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
dielectric spectroscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  1. tFI5Ua2XsEnOSYB
  2. ouRD9D
Product

single-stranded deoxyribonucleic acid modified nanostructure gold

Grain size: < 100 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial