Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Based on

1 Articles
2014 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

carboxyl-terminated nanocrystalline diamond film

NCD:COOH
Type Nano Material
Formula
Role raw materials
2

NH2-modified single-strand DNA

NH2-modified ssDNA
Type Biomolecule
Formula
Role layer

Properties

Applications

Area Application Source
diagnostics

More information available to subscribers only.

Or, view sample content

Characterization

Biological effects

Biological system Test details Source
target ssDNA fragment 5'-AGGAACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATAC ACCCAAAGGATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGA TTCCATTAACAGTAAG-3' with mutation c.1222C>T

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  1. CE6SDAadpjflFtv6bZirCmHeEZXZeISUGzMYgDDXmwdSv
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Method 2

Type: Chemical synthesis
Source:
Starting materials
  1. SseSl7AHFBzQG6OT3cA2InFG5P8P8dkSuGpOoHTxaTMNc
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Method 3

Type: Chemical synthesis
Source:
Starting materials
  1. G3NUdtATv8YXg6OYZe9IFHQuBFmO94SoePliJUECfiop3
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Method 4

Type: Chemical synthesis
Source:
Starting materials
  1. 78saQUT6SO9g30nI1JMZRSvSfEfyrJK6VRrZX2IjV4qg0
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Method 5

Type: Chemical synthesis
Source:
Starting materials
  1. 7HALrNBPG9tu0Yz784viJpZiMhXVhwkDdDhlwLnEt1GcV
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial