Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

deoxyribonucleic acid tetrahedrons

Based on

10 Articles
2017 Most recent source

Composition

1

DNA

Type Biomolecule
Formula
Role framework element
2

DNA

Type Biomolecule
Formula
Role framework element
3

DNA

Type Biomolecule
Formula
Role framework element
4

rhodamine green and DABCYL-labeled deoxyribonucleic acid

RG and DABCYL-labeled DNA
Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
acoustic ratio dependent on tetrahedron state

More information/entries available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Nanomaterial Variant Source
compounds sensor in exosomes from human liver hepatocellular HepG2 cells

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
C57BL/6 mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • deoxyribonucleic acid
  1. 2ur9CbsuKzEk6k5
  2. KUg6U7B
Product

deoxyribonucleic acid tetrahedrons

Width: ~ 17 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  • transfer RNA unit
  1. X1fnn
  2. fdkR
  3. GIn7S
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium/Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • SH-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC
  • SH-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT
  • SH-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
See all (4)
  1. al7CjXbgY0T0uQEwyxDZKdBgUzIVZw
  2. TNWu
  3. 0B0LRZC
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • SH-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC
  • SH-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
  • ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA
See all (4)
  1. cNh13UU5paYd8Ra35ALIdC9vNUfl2U
  2. BoIa
  3. nBx2GaS
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • DNA
  • rhodamine green and DABCYL-labeled deoxyribonucleic acid
  1. QU3QUqEPHMTjxVMBEWDIR1zFJvMLfPSUg94PAfEwiD3sep9NzsXfme5Op95lw0
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial